Board Paper of Class 12-Science 2023 Biology Delhi(Set 1) - Solutions
General Instructions:
Read the following instructions very carefully and strictly follow them:
(i) This question paper contains 33 questions. All questions are compulsory.
(ii) Question paper is divided into FIVE sections - Section A, B, C, D and E.
(iii) In Section A question number 1 to 16 are Multiple Choice (MCQ) type questions carrying 1 mark each.
(iv) In Section B - question number 17 to 21 are Very Short Answer (VSA) type questions carrying 2 marks each.
(v) In Section C - question number 22 to 28 are Short Answer (SA) type questions carrying 3 marks each.
(vi) In Section D - question number 29 and 30 are case-based questions carrying 4 marks each. Each question has subparts with internal choice in one subpart.
(vi) In Section E -question number 31 to 33 are Long Answer (LA) type questions carrying 5 marks each.
(viii) There is no overall choice. However, an internal choice has been provided in 1 question in Section B, 1 question in Section C, 2 questions in Section
D and 1 question in Section E. A candidate has to attempt only one of the alternatives in such questions.
(ix) Wherever necessary, neat and properly labelled diagrams should be drawn.
- Question 1
At which stage during evolution did human use hides to protect their bodies and buried their dead?
(a) Homo habilis
(b) Neanderthal man
(c) Java man
(d) Homo erectusVIEW SOLUTION
- Question 2
Given below are Column A with a list of certain Assisted Reproductive Technologies (ART) and in Column B the procedures followed during ART :
Column A Column B S. No Names of ART S. No Procedures (A) GIFT (i) Transfer of ovum from a donor into the fallopian tube of another female. (B) ICSI (ii) Transfer of semen from the donor into the vagina of the female. (C) ZIFT (iii) Injecting sperms directly into the ovum. (D) IUI (iv) Transfer of early embryos into the fallopian tube.
Choose the option where ART correctly matches with the procedure
(a) (A)-(i), (B)-(ii), (C)-(iii), (D)-(iv)
(b) (A)-(iv), (B)-(i), (C)-(ii), (D)-(iii)
(c) (A)-(iv), (B)-(iii), (C)-(i), (D)-(ii)
(d) (A)-(i), (B)-(iii), (C)-(iv), (D)-(ii)VIEW SOLUTION
- Question 3
The decrease in the T-lymphocytes count in human blood will result in:
(a) Decrease in antigens
(b) Decrease in antibodies
(c) Increase in antibodies
(d) Inerease in antigensVIEW SOLUTION
- Question 4
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3' AUCAGGUUUGUGAUGGUACGA 5'
(a) Phenylalanine, Methionine
(b) Cysteine, Glycine
(c) Alanine, Proline
(d) Serine, Valine VIEW SOLUTION
- Question 5
A Tight one-to-one relationship between many species of fig tree and certain wasps is an example of -
(a) Commensalism
(b) Parasitism
(c) Amensalism
(d) MutualismVIEW SOLUTION
- Question 6
Select the pathogen mismatched with the symptoms of disease caused by it from the list given below:
(a) Entamoeba histolvtica: Constipation, abdominal pain.
(b) Epidermophvton: Dry scaly lesions on nail.
(c) Wuchereria bancrofti: Chronic inflammation of lymphatic vessels of lower limb.
(d) Haemophilus influenzae: Blockage of the intestinal passage.VIEW SOLUTION
- Question 7
The primary productivity in an ecosystem is expressed as:
(a) gm−2 yr−1
(b) gm−2 yr
(c) K cal m−2 yr−1
(d) K cal m−2 VIEW SOLUTION
- Question 8
Given below is the restriction site of a restriction endonuclease Pst-I and the cleavage sites on a DNA molecule.
Choose the option that gives the correct resultant fragments by the action of the enzyme Pst-I.
VIEW SOLUTION
- Question 9
The IUCN Red Data List (2004) in the last 500 years documents the extinction of nearly 784 species including:
(a) 330 invertebrates
(b) 338 invertebrates
(c) 359 invertebrates
(d) 362 invertebrates VIEW SOLUTION
- Question 10
Given below are the list of the commercially important products and their source organisms. Select the option that gives the correct matches.
List A List B S. No. Bioactive Products S. No Microbes (Source Organism) (A)(B)(C)(D)Cyclosporin A
Statins
Streptokinase
Penicillin(i)(ii)(iii)(iv)Streptococcus
Tricoderma polysporum
Penicillium notatum
Monascus purpureus
Options:
(a) (A)-(i), (B)-(ii), (C)-(iii), (D)-(iv)
(b) (A)-(iii), (B)-(iv), (C)-(ii), (D)-(i)
(c) (A)-(iv), (B)-(ii), (C)-(ii), (D)-(i)
(d) (A)-(ii), (B)-(iv), (C)-(i), (D)-(iii) VIEW SOLUTION
- Question 11
Important attributes belonging to a population but not to an individual are:
(i) Birth rate and death rate
(ii) Male and female
(iii) Birth and death
(iv) Sex-ratio
Select the correct option from the given options:
(a) (i) only
(b) (ii) only
(c) (ii) and (iii)
(d) (i) and (iv) VIEW SOLUTION
- Question 12
Select the option that shows the correctly identified 'U', 'X', 'Y' and 'Z' in a developing dicot embryo.
(a) X - Plumule (2n), Y - Suspensor (n), Z - Cotyledon (2n), U - Radicle (2n).
(b) X - Plumule (2n), Y - Suspensor (2n), Z - Radicle (2n), U - Cotyledon (2n).
(c) X - Suspensor (2n), Y - Cotyledon (2n), Z - Radicle (2n), U - Plumule (2n).
(d) X - Cotyledon (2n), Y - Radicle (n), Z - Plumule (n), U - Suspensor (n). VIEW SOLUTION
- Question 13
Assertion (A) : Determining the sex of an unborn child followed by MTP is an illegal practice.
Reason (R) : Amniocentesis is a practice to test the presence of genetic disorders also.
(a) Both (A) and (R) are true and (R) is the correct explanation of (A).
(b) Both (A) and (R) are true, but (R) is not the correct explanation of (A).
(c) (A) is true, but (R) is false.
(d) (A) is false, but (R) is true.VIEW SOLUTION
- Question 14
Assertion (A) : Synthetic oligonucleotide polymers are used during Annealing in a PCR.
Reason (R) : The primers bind to the double stranded DNA at their complementary regions.
(a) Both (A) and (R) are true and (R) is the correct explanation of (A).
(b) Both (A) and (R) are true, but (R) is not the correct explanation of (A).
(c) (A) is true, but (R) is false.
(d) (A) is false, but (R) is true.VIEW SOLUTION
- Question 15
Assertion (A) : Decomposition process is slower if detritus is rich in lignin and cutin.
Reason (R) : Decomposition is largely an oxygen requiring process.
(a) Both (A) and (R) are true and (R) is the correct explanation of (A).
(b) Both (A) and (R) are true, but (R) is not the correct explanation of (A).
(c) (A) is true, but (R) is false.
(d) (A) is false, but (R) is true.VIEW SOLUTION
- Question 16
Assertion (A) : In Thalassemia an abnormal myoglobin chain is synthesized due to a gene defect.
Reason (R) : α-Thalassemia is controlled by genes HBA1 and HBA2 on chromosome 16.
(a) Both (A) and (R) are true and (R) is the correct explanation of (A).
(b) Both (A) and (R) are true, but (R) is not the correct explanation of (A).
(c) (A) is true, but (R) is false.
(d) (A) is false, but (R) is true.VIEW SOLUTION
-
Board Paper of Class 12-Science 2023 Biology Delhi(Set 2) - Solutions
-
Board Paper of Class 12-Science 2023 Biology Delhi(Set 3) - Solutions
-
Board Paper of Class 12 Science Term-II 2022 Biology Delhi(Set 1) - Solutions
-
Board Paper of Class 12 Science Term-II 2022 Biology Delhi(Set 2) - Solutions
-
Board Paper of Class 12 Science Term-II 2022 Biology Delhi(Set 3) - Solutions
-
Board Paper of Class 12 Science Term-I 2021 Biology Delhi(Set 4) (Series: SSK/3) - Solutions
-
Board Paper of Class 12-Science 2020 Biology Delhi(Set 1) - Solutions
-
Board Paper of Class 12-Science 2020 Biology Delhi(Set 2) - Solutions
-
Board Paper of Class 12-Science 2020 Biology Delhi(Set 3) - Solutions
-
Board Paper of Class 12-Science 2019 Biology Delhi(Set 1) - Solutions
-
Board Paper of Class 12-Science 2019 Biology Delhi(Set 2) - Solutions
-
Board Paper of Class 12-Science 2019 Biology All India(Set 3) - Solutions
-
Board Paper of Class 12-Science 2019 Biology Abroad(Set 1) - Solutions
-
Board Paper of Class 12-Science 2018 Biology (SET 1) - Solutions
-
Board Paper of Class 12-Science 2018 Biology (SET 2) - Solutions
-
Board Paper of Class 12-Science 2018 Biology (SET 3) - Solutions
-
Board Paper of Class 12-Science 2017 Biology (SET 1) - Solutions
-
Board Paper of Class 12-Science 2017 Biology (SET 2) - Solutions
-
Board Paper of Class 12-Science 2017 Biology (SET 3) - Solutions
-
Board Paper of Class 12-Science 2016 Biology (SET 1) - Solutions
-
Board Paper of Class 12-Science 2016 Biology (SET 2) - Solutions
-
Board Paper of Class 12-Science 2016 Biology (SET 3) - Solutions
-
Board Paper of Class 12-Science 2016 Biology (SET 1) - Solutions
-
Board Paper of Class 12-Science 2015 Biology (SET 1) - Solutions
-
Board Paper of Class 12-Science 2015 Biology (SET 2) - Solutions
-
Board Paper of Class 12-Science 2015 Biology (SET 3) - Solutions
-
Board Paper of Class 12-Science 2015 Biology (SET 1) - Solutions
-
Board Paper of Class 12-Science 2015 Biology (SET 2) - Solutions
-
Board Paper of Class 12-Science 2015 Biology (SET 3) - Solutions
-
Board Paper of Class 12-Science 2014 Biology (SET 1) - Solutions
-
Board Paper of Class 12-Science 2014 Biology (SET 2) - Solutions
-
Board Paper of Class 12-Science 2014 Biology (SET 3) - Solutions
-
Board Paper of Class 12-Science 2016 Biology (SET 2) - Solutions
-
Board Paper of Class 12-Science 2013 Biology (SET 1) - Solutions
-
Board Paper of Class 12-Science 2013 Biology (SET 2) - Solutions
-
Board Paper of Class 12-Science 2013 Biology (SET 3) - Solutions
-
Board Paper of Class 12-Science 2012 Biology (SET 1) - Solutions
-
Board Paper of Class 12-Science 2012 Biology (SET 2) - Solutions
-
Board Paper of Class 12-Science 2012 Biology (SET 3) - Solutions
-
Board Paper of Class 12-Science 2012 Biology (SET 2) - Solutions
-
Board Paper of Class 12-Science 2011 Biology (SET 1) - Solutions
-
Board Paper of Class 12-Science 2011 Biology (SET 3) - Solutions
-
Board Paper of Class 12-Science 2010 Biology (SET 3) - Solutions
-
Board Paper of Class 12-Science 2009 Biology (SET 1) - Solutions
-
Board Paper of Class 12-Science 2008 Biology (SET 1) - Solutions
-
Board Paper of Class 12-Science 2008 Biology (SET 1) - Solutions
-
Board Paper of Class 12-Science 2007 Biology (SET 1) - Solutions
-
Board Paper of Class 12-Science 2006 Biology (SET 1) - Solutions
-
Board Paper of Class 12-Science 2006 Biology (SET 1) - Solutions
-
Board Paper of Class 12-Science 2005 Biology (SET 1) - Solutions
-
Board Paper of Class 12-Science 2005 Biology (SET 1) - Solutions
-
Board Paper of Class 12-Science 2004 Biology (SET 1) - Solutions
-
Board Paper of Class 12-Science 2004 Biology (SET 1) - Solutions